AutismDescribes a wide spectrum of developmental disorders affecting four times as many boys and girls. The expert-reviewed book takes the reader through the history of the disorder, explaining in detail its symptoms, diagnosis, and treatment. It also lays our the most current explanation of the disorder, as well as the best ways to researchers have found to treat the symptoms. The last chapter is dedicated to explaining how researchers are working to design |
Other editions - View all
Common terms and phrases
ACE center activity Adrian Bird affected by autism allows researchers antibodies aspect to autism Asperger syndrome Autism affects Autism Gene Autism Research Institute autism spectrum disorders autism-like autistic children Bernard Rimland Bettelheim blood called carries the code Catherine Lord cause autism cerebellum chemicals childhood disintegrative disorder children with autism contribute to autism defective genes developmental disorder diagnosed disabilities diseases and disorders doctors experts faulty genes Floortime fMRI form of autism function genes responsible genetic basis genetic engineering genetic engineering techniques genome Hans Asperger high-functioning autism identify immune system Infantile Autism Institutes of Health lead to autism link to autism live MECP2 mice MMR vaccine National Institutes nerve cells normal number of children parents performed person’s play a role problems proteins responsible for autism Retrieved August 20 Rett syndrome role in autism Rosen Publishing schizophrenia scientists social skills symptoms TCGATTCTGAACATGATACGTACTGGTCCACTAGAACTGAACTCGAGAGGTACTAGAGT tests treat treatment for autism University